FAQ

We developed this web-based server to process 4C-Seq data generated from Illumina high-throughput sequencers, such as HiSeq 2000. In the last decade, long-range chromatin-chromatin interaction in the nucleus has been gradually recognized as an epigenetic regulator. In particular, a high-throughput sequencing approach (4C-Seq) based on circular chromosome conformation capture (4C) has been developed to explore genome-wide interactions of a particular locus. Unlike array-based genomic data, processing of next-generation sequencing (NGS) data is a big challenge for a bench scientist.

This w4CSeq web server aimed to provide a simple and easy to use interface for the users to process 4C-Seq raw data generated by an Illumina sequencer, therefore even the users without bioinformatics background can extract biological insight from millions lines of AGCT reads.

Yes. w4CSeq is a fast and efficient web server to process high-throughput DNA sequencing data from 4C libraries that are prepared by either enzyme-based or sonication-based method. In spite of technical difference in chromatin fragmentation, both enzyme-based and sonication-based 4C-Seq approaches are valuable tools. w4CSeq server provides bioinformatic pipelines for both approaches, thus the users can select their favorite method to prepare 4C libraries for sequencing.

The expected results from w4CSeq server include Summary Report, Interaction Circos Map, Interaction Density Map, and the link to a Bed file with Significant Interacting Regions(Sites) that the users can load to their own genome browsers. We hope this server can help biologists interested in 4C-Seq take full advantage of high-thoughput sequencing data to expedite scientific discoveries without spending much time on intensive and boring data mining.

We not only provides command line tools, but also web applications that users can install in their own environment. This website is a demo server for you to examine, thus may not handle large amounts of data.

1. Make sure you input correct parameters.
For example, when you provide DNA sequence of 4C target region, suppose chromatin is fragmented with HindIII, your bait primer ATCTGCTATTGAGGAAGCTT should contain a HindIII cutting site AAGCTT at 3' end. Then you should input the DNA sequence ATCTGCTATTGAGGAAGCTT. The analysis cannot be performed if you input ATCTGCTATTGAGG or AAGCTTCCTCAATAGCAGAT. For the latter, you may reverse complement the sequence to ATCTGCTATTGAGGAAGCTT and use that as input.